الفهرس 
List of AbbreviationsOnly 14 pages are availabe for public view
 |  | from | 114 |  |  |
| | | from | 114 | | |
Abstract
H. nana is one of the most common cestodes in humans, domestic and wild rodents. Since isolates of H. nana species are morphologically identical, the way they can be reliably distinguished is comparing the parasite using molecular techniques.
Therefore, this study aimed to estimate the prevalence of H. nana infection in patients attending Sohag hospitals and correlation with some its risk factors and clinical manifestations; to identify the genomic diversity of its human isolates and determine their transmission patterns in Sohag using DNA sequencing analysis of the COX1 gene of isolates; and to construct the phylogenetic tree to assess the evolutionary relationship of its isolates from different individuals and different hosts and to provide additional information on the molecular epidemiology of this parasite in our locality. This will also allow a more appropriate approach to control the infection in endemic communities.
Study design, Sample collection and laboratory processing
A cross-sectional study was conducted on 500 outpatients attending the lab of Sohag University Hospital and Endemic Diseases Hospital aged 1 to 15 years with (Mean 8.5 years ± 3.8 SD) during the period from November 2018 to June 2019 in Sohag Governorate, Egypt. 213 (42.6%) were males and the rest 287 (57.4 %) were females.
Demographic and lifestyle were obtained through a survey questionnaire. The questionnaire included age, sex, residence, maternal educational level, family size presence of infected siblings, washing of vegetables and fruits before consumption, washing hands before eating and after defecation, trimming finger nails periodically, other associated symptoms of abdominal pain, anorexia, diarrhea and vomiting. Body mass index (BMI) was also recorded.
Samples were examined by macroscopically for presence of worms or their segments and microscopically by direct smear method, Lugol’s iodine, followed by formol ether concentration technique. Smears were reported as positive if H. nana eggs were detected. Results were tabulated and statistically analyzed. Only H. nana positive samples, which were negative for other intestinal parasites, were used for DNA extraction.
DNA Extraction
20 positive stool samples were sieved, washed with distilled water by centrifugation for 10 min and stored in -20˚C until used for DNA extraction. Genomic DNA was extracted using QIAamp DNA Mini Stool Kit (Qiagen, Germany) ac¬cording to the manufacturer’s instructions. Eluted DNA was analyzed with PCR.
PCR Amplification Protocol
A 391 bp DNA fragment of mt COX1 gene of H. nana was amplified by Conventional PCR, using the following primer pairs; the forward pr-a (5′ TGGTTTTTTGTGCATCCTGAGGTTTA 3′) and the reverse pr-b (5′ AGAAAGAACGTAATGAAAATGAGCAAC 3′).
PCR reactions were performed in Thermal Cycler (Veriti, Applied Biosystems, USA) using the following cycling protocol : an initial denaturation at 94°C for 1 min 50 sec followed by 30 cycles each consisting of 94°C for 50 sec, 55°C for 1min 30 sec and 72°C for 1min 30 sec. Lastly final extension was at 72°C for 7 min.
Agarose gel electrophoresis of PCR products
PCR products were electrophoresed on a 1.5% agarose gel stained with ethidium bromide in l x TAE buffer. A 100 bp DNA ladder and negative control were loaded in each gel then visualized under UV transilluminator.
Sequence analysis
PCR products were purified by using a QIAquick PCR purification kit (Qiagen, Germany) according to the manufacturer’s instructions. Purified PCR products were sequenced by Sanger method in both directions with PCR primers on an automated sequencer (the ABI Prism 310 Genetic Analyzer, Applied Biosystems, USA), using a BigDye Terminator Cycle Sequencing kit (Applied Biosystems, USA) according to manufacturer’s instructions.
The sequences obtained in the present study were aligned with available reference sequences downloaded from GenBank database using the Basic Local Alignment Search Tool (BLAST). Multiple alignment analysis was performed with Clustal X2 computer program. Representative nucleotide sequences ob¬tained in this study were deposited in the GenBank database.
Phylogenetic analyses
The phylogenetic trees were constructed using NJ method and ML. The trees were evaluated using the bootstrap test based on 1000 resamplings. The percentage of replicate trees or node reliability was shown next to the branches. The trees were drawn to scale, with branch lengths measured in number of nucleotide substitutions per site. All positions containing gaps and missing data were eliminated from the dataset. Pairwise distances were estimated using p distance method. Phylogenetic analyses were conducted in MEGA 7.
The study resulted in:
The prevalence of H. nana infection was estimated to be 5.8% (29/500). Of 29 patients, 15 were males and 14 were females. The prevalence among males was 7.1% (15/213) where in females the prevalence was 4.8% (14/287). Coinfection of H. nana with Giardia lamblia was found in 4 patients (0.8%), also H. nana with E. histolytica was detected in two patients (0.4%).
There was a significant association between the prevalence and the age groups 1 - 3 years (5%), 3 – 5 years (6.6%), 5 - 7 years (17.6%), 7 - 9 years (7.5%), 9 -11 years (3.2%),11-13 years (2.9%) and 13 - 15 years (1.6%) (P value < 0.005). The highest prevalence was observed among age group of 5–7 years.
Univariate regression analysis for risk factors associated with H. nana infection showed that Male patients (7.1%) had a higher prevalence than females (4.8%) however no significant association was found between the gender and the infection (P value < 0.3; COR = 1.4; 95% CI = 0.6-3.1).
However, patients with younger age group 1-8 years (8.9%) had a higher prevalence compared to older age group 8-15 years (3.6%). The infection was significantly associated with age (P value < 0.01; COR = 2.5; 95% CI =1.1-5.5).
Similarly, patients in rural areas (7.8%) were 2.5 times more prone to the infection than those living in urban areas (3.2%). Residence was significantly risk factor for the infection (P value < 0.03; COR = 2.5; 95% CI=1.1-6.1).
Also, patients with uneducated mothers (9.2%) were more likely to be infected than those with educated mothers (3.6%). The prevalence was significantly associated with mother educational level (P value < 0.01; COR=2.7; 95% CI = 1.2-5.8).
As well, the patients with family sizes more than 5 members (7.8%) had a significantly higher prevalence than those from smaller families (3.4%). Family size was significantly risk factor for the infection (P value < 0.04; COR = 2.4; 95% CI = 1.1-5.5).
Patients residing with an infected sibling were 2.3 times more at risk of infection than those residing with non-infected siblings. There was also a significant association between the infection and presence of infected sibling (P value < 0.02; COR = 2.3; 95% CI = 1.1-5.1).
Patients who consumed raw or unwashed vegetables and fruits had higher odds ratio to be infected than those who did not consume them. The prevalence was significantly associated with consuming unwashed vegetable and fruits (P value < 0.0001; COR = 4.3; 95% CI = 1.9-9.7).
Patients who did not have a hand washing habit before eating and after defecation were 4.5 times more likely to be infected compared with their counter parts. The prevalence was significantly associated with poor hand washing before eating and defecation (P value < 0.001; COR = 4.5; 95%CI = 1.8- 11.4).
Patients who did not have the habit of cutting their fingernails were 3.9 times more likely to be infected than those who did cut their fingernails. Untrimmed fingernails were significantly associated with the prevalence (P value < 0.002; COR = 3.9; 95%CI = 1.6-9.4).
Significant risk factors from univariate analysis were entered into multivariate logistic regression model to eliminate possible confounding relationships among variables.
Multivariate logistic regression analysis retained 4 risk factors that remained significantly associated with H. nana infection among studied participants.
The results confirmed that the age of 1-8 years (P value < 0.03; AOR = 2.9; 95% CI = 1.1-7.8) and low mothers’ education (P value < 0.04; AOR = 3.1; 95% CI = 1.1-9.1), consuming unwashed vegetables and fruits (P value < 0.01; AOR = 4.9; 95% CI = 1.4-17.2) and poor hand washing before eating and after defecation (P value < 0.005; AOR= 5.6; 95% CI = 1.6-19.2) were retained as significant risk factors of the infection among these people.
Among the participants,186 individuals (37.2%) who were referred to the medical laboratories for checkup had no symptoms and 314 (62.8%) individuals suffered from at least one symptom.
The prevalence was insignificantly higher in symptomatic patients (6.3%, 20/314) than in asymptomatic carriers (4.8%, 9/186) (P value < 0.4).
The infection was significantly higher among those who had abdominal pain (10.3 %) when compared to asymptomatic counterparts (2.9%) (P value < 0.001).
Similarly, the prevalence was significantly higher among those who had anorexia (10.1%) compared to the asymptomatic individuals (3.6 %) (P value < 0.005).
In addition to it was significantly was higher among underweight participants (9.1%) when compared to normal weight participants (3.6%) (P value < 0.01).
However, it was not significantly associated with diarrhea (P value < 0.1), vomiting (P value < 0.2) and headache (P value < 0.6)
Conventional PCR
PCR-amplification of mt COX-1 gene of 20 H. nana human isolates yielded a single band of approximately 391 bp on gel electrophoresis.
Sequence Analysis and Submission to NCBI
20 isolates were successfully sequenced by amplification with primers pr-a and pr-b and showed that all PCR products had nucleotides belonging to H. nana.
The COX1 gene sequences obtained were the same in length (391 bp) among all specimens and 20 isolates produced 5 different COX1 gene sequences which had the largest similarity with H. nana human isolates from Mexico (MN536021). Variation occurred in terms nucleotide substitutions (transition and transversion). Five nucleotide substitutions were shown at positions 71, 243, 264, 350. Two mutations from them were transition changes (T to C at 246 and G to A at 350) and three transversion changes (T to A at 71, A to T at 243 and G to T at 350).
The annotated sequences of Egyptian H. nana isolates were deposited in the GenBank of NCBI under the following accession number; MT093851, MT093852, MT093853, MT093854 and MT093855.
Phylogenetic analysis.
Molecular phylogenetic trees were constructed using NJ and ML methods based on 26 COX1 nucleotide sequences obtained in this study. NJ and ML trees were inferred with p distance and GTR+I+G substitution model respectively.
P. westermani (AB354225) was used as the outgroup. Bootstrap resampling of 1,000 replicates was done. Both NJ and ML analyses produced trees with the same topology and approximate relatively bootstrapped values.
Phylogenetic analysis of the COX1 nucleotide sequences revealed all H. nana human isolates of present study gathered with human and rodent isolates of previous studies in one clade with a high bootstrap support (99%) despite their host susceptibility differences. This clade is composed of three subclades of H. nana isolates.
First subclade consisted of human isolates from present study, Egypt (Gu433104), Colombia (KT362138), Paraiso, Mexico (MN536021) and Sinaloa, Mexico (HM447234) with a low bootstrap support (23% in NJ tree or 20% in ML tree).
Second subclade consisted of mouse isolate from Japan (AB494471), hamster isolate from Uruguay (AB494472), mouse isolate from China (KT951722), mouse isolate from Japan (LC063187), rat isolate from India (KU821727), rat isolate from China (KY079336) and both rat and hamster isolates from Slovakia (MK874334, MK874335) with moderate bootstrap support (68% in NJ tree or 65% in ML tree).
Third subclade consisted of rat isolate from Egypt (GU433103), rat isolate from Spain (JN258053) and both rat and hamster isolates from Slovakia (MK874332, MK874333) with a high bootstrap support (96% in NJ tree or 94% in ML tree).
The topology within the subclades suggested that H. nana human isolates of present study were closely related which means they came from the same origin, were more related to H. nana infecting human of previous studies especially Latin America due to migration, differed notably from rodent isolates of previous studies which supported that the transmission of infection from rodent to human was less likely to happen and were different from human isolate of Australia. This was explained by a difference in the evolution of Australian isolates due to early separated from rest of the world.
Intraspecific variations ranged from 0 to 0.6 % within human isolates of the present study, ranged from 0 to 4% between the human isolates of present study and human isolates of the previous studies and ranged from 0.6% to 4% between the human isolates of present study and rodent isolates of the previous studies.
Conclusion
Our finding also revealed that habits of poor hand washing before meal and after toilet, and consuming unwashed vegetables and fruits were significantly associated with the prevalence of H. nana infection. Provision of washing vegetables and fruits and proper education on personal hygiene sanitation are very important parameters to improve the rate of its prevalence.
In addition, our results indicate the further need to study the phylogeny of H. nana and characterizing the genetic differences within its population, not only at the individual gene level, but also at the whole genome level.
Furthermore, it would be highly useful to characterize a much larger number of human isolates from different geographical regions. This would provide additional data to identify sources of human hymenolepiasis and to confirm the existence of a true genetically uniform, phylogenetically separated cluster and thus is recommended for future work.
Because of the possibility of zoonotic transmission and the potential of household rodent for hosting the parasite suggested by some researchers, further studies with rodent stool samples are recommended using additional, more highly variable loci which will more definitively evidence of anthroponotic or zoonotic transmission in our community.