الفهرس 
AcknowledgmentOnly 14 pages are availabe for public view
 |  | from | 98 |  |  |
| | | from | 98 | | |
Abstract
Cronobacter sakazakii (C. sakazakii) has recently attracted considerable attention being an emerging neonatal pathogen, and has also been associated with the outbreaks of life-threatening septicemia, as well as necrotizing enterocolitis, and meningitis in neonates and infants worldwide.
Powdered infant formula was first thought to be the only source of neonatal/infantile infections. However, it is clear now that contamination of reconstituted PIF can occur both intrinsically and extrinsically.
The disease is associated with the consumption of contaminated rehydrated PIF, as Cronobacter spp. can withstand desiccation in dried foods like PIF and are known to survive in reconstituted formula.
This study was aimed to test the commercially available infant formulas intended for consumption by infants aging from 0-6 months, for the presence of Cronobacter spp., as well as determining the incidence of C. sakazakii in the stool of these infants fed on these formulas who are suffering from gastroenteritis, through conventional methods including culture and biochemical identification and PCR.
A total number of 50 Powdered infant formulas ( PIF ) were collected from formulas used for infants at Assiut University Pediatric Hospital in Assiut city.
Stool swabs were collected from infants and neonates at infant incubators and at the Gastroenterology and Hepatology unit of Assiut University Pediatric Hospital. A total of 50 samples were collected (40 samples from diarrheic infants & 10 samples from non diarrheic infants).
Our present study revealed that C. sakazakii was isolated in a percentage of 43.75% from PIF collected from infants aged 1-3 months, and in a percentage of 55.55% in PIF samples of infants aged 4-6 months, with a total percentage of 48% PIF samples positive for C. sakazakii.
As for the PIF samples collected from incubators C. sakazakii was isolated from 22.22% of the total collected samples.
The collected stool samples revealed a total percentage of 50% positive stool samples for C. sakazakii, with a percentage of 53.125% positive samples in ages from 1-3 months, and 44.44% positive stool samples in infants aged 4-6 months fed on these formulas.
Some biochemical tests were done revealing that C. sakazakii shows positive results for catalase and citrate utilization tests, while giving negative results for urease test.
For the confirmation of the isolates and screening the presence of C. sakazakii PCR was used. The amplification of ESA_02797 gene allowed the specific detection of all the C. sakazakii strains by using a pair of primers (Fw: GGCAGCATGTCATTATCGG, Rv: CATCAGTGGCATTCGGTCTA) that amplify a fragment sized 152bp.
Finally, the analysis of the study results similarities showed that 30% of the infants who consumed PIF samples proven to be contaminated with C. sakazakii showed positive isolates in their stool samples as well.